Query (optional)   in Class  

GrainGenes Probe Report: BF291774-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF291774-6A
Data at Wheat_SNP
BF291774-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 481
SNP T>C;A>G;C>A at 160;400;623
Reference sequence TTGTCGCAATCGTCGTCAAGGACATGACAGGAAATAATGTATGTGTGCTAAATTGCATCCAAGTGTTTCATCAATTTGTGTTAGTATCTGCTTTATGCTGCATTTTTTTGTTCTCTTGTCCTGATATTACACTATTACTCCTTTGTTTGTGTTGAAGGGTTGGGTGTTTCCCCTGACTCTGTTGGGCATTATTCCTTTGGCCGAGCGACTGGGCTTCGCCACCGAGTAATTGTTACATTTTTCATACTTATATAATGATCCTTGTTGATATTGTTGAACAAACATTTGACACTTTACTTCTTACTGCAGGCAGTTAGCATTCTTCACAGGCCCAACAGGTCTCACTCAGTTGCTCTTCTTCGAAGCATTTTGATCCGACTAGCATTCGTATTGATTATGAAAAATTTCATGTGCATGCAGTTGGGGGCCTTCTGAATGCTACATTTGGAAATGCGACCGAGTTGATTATATCGATCCATGCGCTAAGGAGTGGAAAGTTACGAGTTGTCCAGCAGTCTCTGCTAGGGTCCATCCTGTCAAACTTGCTTCTGGTTCTCGGTTGCGCATTTTTCAGTGGAGGGGTCACTTGTGGCAAAACTGAGCAGAACTTCAGCAAGGTGACCATTCTTGTCTGTTCACAGATTTGCACAATGTAGATGAGAGTGCTCATTCTGT
Type
EST
SNP
PCR primers
BF291774A_F1 TACCGTGTGGCTTTGTCGCA
BF291774A_R1 CTCTGACTGCAACAACACAG
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01