Query (optional)   in Class  

GrainGenes Probe Report: BF291774-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF291774-6B
Data at Wheat_SNP
BF291774-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;G>A;G>A;T>A;DEL;C>T;T>C;G>A;A>G at 175;281;341;363;375-376;408;417;445;515
Reference sequence TCAAAGCTCAACCTGTTGATACCGTGTGGCTTTGTGGCGATCGTCGTCAAGGACATGACAGGAAATAATGTACGTGTGATAAATTATTGCATCGAAGTGTTTCATCAATTTGTGTTAGTATCTGCTTTATGCTGCATTTTTTGGTGTTCTTGTCCTGATATTACACTGTTACTCCTTTGTTTGTGCTGAAGGGCTGGGTATTTCCCCTGACTCTGTTGGGCATTATTCCTTTGGCCGAACGACTGGGTTTCGCCACCGAGTAATTTGTTACAGTTTTCACGCTTGTTTGGTGATCCTTGTTGATCTTACTGAACAAACATCTGACACTCTGCTTCTTACTGCAGGCAGTTAGCATTCTTCACTGGCCCAACAGGTCTCTCACTCTGTTGCTCTTCTTTGAAGCATTCCGATCCAAGTAGCATTCGAATTGTCGTTGGCTTGACAGATTTCATGTGCATGCAGTTGGGGGCCTTCTGAATGCTACATTTGGCAATGCAACCGAGTTGATTATATCAATCCATGCGCTAAGGAGCGGAAAGTTACGAGTTGTCCAGCAGTCTCTGCTAGGGTCCATCCTGTCAAACTTGCTTCTGGTTCTCGGTTGCGCATTT
Type
EST
SNP
PCR primers
BF291774B_R1 CCTTGCTGAAATTCTGCTCC
BF291774_cpF1 GTAGCCTGAAGTTTGTGCTG
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01