Query (optional)   in Class  

GrainGenes Probe Report: BF292193-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF292193-7D
Data at Wheat_SNP
BF292193-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;DEL;INS at 445,12;479-491;701,27
[ Show all 7 ]
Type
EST
SNP
PCR primers
BF292193_cpR1 CTCGATGCTTCCAATCAGGT
BF292193D_F1 TTGGAAATATAGGAGACCAACA
Sequence
NSFT03P2_Contig8065
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01