Query (optional)   in Class  

GrainGenes Probe Report: BF292295-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF292295-3A
Data at Wheat_SNP
BF292295-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A at 309
SNP T>C;G>A at 33;278
Reference sequence CATGGCATACCTCACGAATGTGTTTTTCCCTTTAGGAGGCCGTAGCTGCCCAGTCCACTATTGCTCATGAACTTGGTGAGATGCCTACAGTCTCTATGCCTGAGGTAGGCTACAACACGAAAGCATATTTAATTTCATGCCAGGCGAAAATTACATTTTAGATATTGCACATGTAGCCAGTTGCTATATTTGCATTCCCTATCATGATGGCAGAGGCAAACGAAACATTTCTTCAACCAAATTGTCCTGGTTTTCATCTTTGTTTTTATATATATCCGCTCTTCTTCAGGAAAGCAAGCCTAAGCCACCTCCGAAGAGGAGCCAGCCTGAGTTCCTGAGAAATATTACAGTTTCCGTGAAGCCACGAGCCAAGAAGGCAAAATCTGACTTGGAATGTAAGCCCGCTCCCAAGGAGTTGGTGCCTTCGAATGGGCATGTAACAAACC
Type
EST
SNP
PCR primers
BF292295A_F2 GACTCACTCACATGGCATACCTCAC
BF292295_cpR3 cggtttgtatcatgcccattcg
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01