Query (optional)   in Class  

GrainGenes Probe Report: BF293133-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF293133-3A
Data at Wheat_SNP
BF293133-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
[ Hide all but 1 of 7 ]
SNP A>G at 68
SNP T>C;T>C;DEL;C>G;G>C;C>G;C>G;G>C;C>G at 19;67;81-82;137;218;248;269;272;275
SNP C>G at 56
SNP INS at 80,3
SNP DEL at 81-82
Reference sequence TCATGGGGGTGCTGGCGCTGCAGTTCCTGCTCGCCGGCTTCCACATCGTCAGCCGCGCGGCGCTCAACATGGGCATCAGCAAGCTCGTCTTCATCGTCTACCGCAACGTCATCTCCCTCGCCCTCCTCGCCCCCTTCGCCTACTTCCTCGAGAAGTACGTCCGCGCCTCCACCATTCTTCTTCTCCGCTTCTTCTTCCAGCAATGGTGGTGGACGGTTTTCTGAATCCTGGTAGTGTCTCTGTTTTTCTTCTTCTTCTTCAGGAAGGACAGGCCGCCGCTCACCTTCTCGCTGCTGGCCGAGTTCTTCGTGCTGGCGCTCATCGGGATCACGGCGAACCAGGGGTTCTACCTGCTGGGGCTGTACCACCTGTCGCCGACGTACGCGTCGGCGATCCAGAACATGGTGCCCGCCATCACCTTCGTGCTGGCCGCGGTCCTCCGGCTGGAGCAGGTGGACCTGGGCCGGCGGCACGGGGTGGCCAAGGTGGTGGGCACGGTGGTGAGCATCGGGGGCGCCACGGTG
Reference sequence CTCCAACCCATCTTCTTCTCCGCTTCTTCTTCCAGCAATGGTGGTGGACGGTTTTCTGAATCCTGGTAGTGTCTCTGTTTTTCTTCTTCTTCTTCTTCAGGAAGGACAGGCCGCCGCTCACCTTCTCGCTGCTGGCCGAGTTCTTCGTGCTGGCGCTCATCGGGATCACGGCGAACCAGGGGTTCTACCTGCTGGGGCTGTACCACCTGTCGCCGACGTACGCGTCGGCGATCCAGAACATGGTGCCCGCCATCACCTTCGTGCTGGCCGCGGTCCTCCGGCTGGAGCAGGTGGACCTGGGCCGGCGGCACGGGGTGGCCAAGGTGGTGGGCACGGTGGTGAGCATCGGGGGCGCCACGGTGACAACGCTCT
Type
EST
SNP
PCR primers
BF293133A_F1_UMN CGCCTCCACCATTCTTCTT
BF293133_cpR1_UMN GTAGAGCGTGATCACCGTGG
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01