Query (optional)   in Class  

GrainGenes Probe Report: BF293133-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF293133-3B
Data at Wheat_SNP
BF293133-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G at 17
SNP C>A at 13
SNP G>C at 75
Reference sequence AGAAGTATGCCGCCGCCTCCATTCTTCTTCTCTGCTTCATCTTCCAGCAGTTTCAAGAAAGCTTCTGCCAGTCAGTCAGAAAACAATGGCGGTGTACAGTTTTTTGAATCCTGGCGTGTCTGTTCTTTTTTCCATCATTCAGGAAGGACCGGCCGCCGCTCACCTTCTCGCTGCTGGCGGAGTTCTTCGTGCTGGCGCTCATCGGGATCACGGCGAACCAGGGGTTCTACCTGCTGGGGCTGTACCACCTGTCGCCGACCTACGCCTCCGCGATCCAGAACATGGTGCCGGCCATCACCTTCGTGCTGGCCGCGGTCCTCCGGCTGGAGCAGGTGGACCTGGGCCGGCGGCATGGGGTGGCCAAGGTGGTGGGCACGGTGGTGAGCATCGGCGGCGCCACGGTGACACCGCCT
Type
EST
SNP
PCR primers
BF293133B_F1_UMN TACTTCCTCGAGAAGTACGCCG
BF293133_cpR1_UMN GTAGAGCGTGATCACCGTGG
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01