Query (optional)   in Class  

GrainGenes Probe Report: BF293133-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF293133-3D
Data at Wheat_SNP
BF293133-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;G>T at 252;403
SNP G>T at 188
SNP T>G;INS at 24;24,2
Reference sequence TCATGGGGGTGCTGGCGCTGCAGTTCCTGCTCGCCGGCTTCCACATCGTCAGCCGGGCGGCGCTCAACATGGGCATCAGCAAGCTCGTCTTCATCGTCTACCGCAACGTCATCTCCCTCGCCCTCCTCGCCCCCTTCGCCTACTTCCTCGAGAAGTACGTCCGCGCCTCCACCATTCTTCTCGATCTGCTTCTTCTTCCAGCAATGGCGGTGGACGGTTTTCTCAATCCTGGTGTGTTTGTTCTTTTTTTTTCTTCAGGAAGGACCGGCCGCCGCTCACCTTCTCGCTGCTGGCGGAGTTCTTCGTGCTGGCGCTCATCGGGATCACGGCGAACCAGGGGTTCTACCTGCTGGGGCTGTACCACCTGTCGCCGACCTACGCGTCGGCGATCCAGAACATGGTGCCAGCCATCACCTTCGTGCTGGCCACGGTCCTCCGGCTGGAGCAGGTGGACCTGGGCCGGCGGCACGGGGTGGCCAAGGTGGTGGGCACCGTGGTGAGCATCGGCGGCGCCACGGT
Reference sequence CGGTTTTCTCAATCCTGGTGTGTTTGTTCTTTTTTTTCTTCAGGAAGGACCGGCCGCCGCTCACCTTCTCGCTGCTGGCGGAGTTCTTCGTGCTGGCGCTCATCGGGATCACGGCGAACCAGGGGTTCTACCTGCTGGGGCTGTACCACCTGTCGCCGACCTACGCGTCGGCGATCCAGAACATGGTGCCAGCCATCACCTTCGTGCTGGCCACGGTCCTCCGGCTGGAGCAGGTGGACCTGGGCCGGCGGCACGGGGTGGCCAAGGTGGTGGGCACCGTGGTGAGCATCGGCGGCGCCACGGTGACAA
Type
EST
SNP
PCR primers
BF293133_cpR1_UMN GTAGAGCGTGATCACCGTGG
BF293133D_F1_UMN GCGGTGGACGGTTTTCTC
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01