Query (optional)   in Class  

GrainGenes Probe Report: BF293541-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF293541-4A
Data at Wheat_SNP
BF293541-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C at 88
Reference sequence GCATTATGGAAGGTAAGTTTGATATGTTGTTGTGTAGAGTTTACTCTTGCACACTGCCACTTTCTTCTTATGCTTGAATTACCGTGTACAGGCTGCTAAGGAAGGTGAGCCTTCTTGGGAGAGCCCTTGGGGTGACGGAAGACCAGGATGGCATATTGAATGCAGTGCGATGAGTGCTCACTATCTAGGGCACGTGTTTGATATTCATGGTGGAGGCAAAGATTTGATATTTCCTCATCATGAGAATGAGCTTGCACAAAGCCGAGCGGCTTATCCAGAAAGTGAGGTCAAATGCTGGATGCATAATGGCTTT
Type
EST
SNP
PCR primers
BF293541A_F1 TGCATTATGGAAGGTAAGTTTGATAT
BF293541_cpR1 AAAGCCATTATGCATCCAGC
Sequence
NSFT03P2_Contig15600
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01