Query (optional)   in Class  

GrainGenes Probe Report: BF428701-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF428701-6B
Data at Wheat_SNP
BF428701-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A at 290
SNP G>A at 571
SNP G>A;A>T at 571;595
SNP A>T;G>A at 447;571
Reference sequence GCAGTTAGGGAACCACGGAGTTCTTGAACCGCTTGGATTCGCGAGGAACCGACTTTGGAGTGTTGATGAGAGTCCTCCTCTTCCAGATACCACTTCTGATTGTCATATTGACTTGATACTCAAGCAGTCTGAAGAAGATATGAAGACCTGGCCACACAGGTTTGTGTCTAGTAAATATTAAATTCCTTGTTCCCATGTTAAATTGATGATGTTGATTATCCTTACATTGCAGTTATGAACTTCGTTTGCAAGTTGCTCTTAGTCCGAGGGGAGATCTGATCCTCACATCTCGAATAAAAAATAAGAATGCTGATGGCAAGCCATTCCAATTTACTTTTGCATACCACACATACTTTTCAGTCTCTGATATCAGGTACCTTTTGGAATGTTACTTTATTTCCTAATTTTTTTGTTTGTATTAACTTGTATTTGTATTTCCTGAAATTATTTTGTTGGGAAGGACTGACTGTACCTTCTATAGCATTTTCTGTAGTGCTGAGTCATGTTGAATGAGCCATTTTAGGATTCAATACTTCAGCACTATTTCAATTGCAGAATAGATACACTTGCGAATGAACAACTTGGCTATTACACATTTTTTTTTACTTAGGCACTATTTTAGGATTTAATATTTTGTTCTCTGAAGCATGTGTTTCACATTCCAGCGAAGTACGGGTTGAGGGTTTGGATACCTTGGACTATCATGATCATCTACAATCTAAGATTCGTTGTACTGAACAAGGCGATGCAGTTGTATTCGAATCTGAAGTAAGCTTTGTATCTGCTTCATATTATGGGGCCACTGTGGTAAGTCACTAACTGTGTTGAACGTTGATTATGAAGGTGGACAGGATATATCTAAGTGCCCCACCCAAGATTGTGACAATTGACCA
Type
EST
SNP
PCR primers
BF428701B_R1 ACAACCTGACACCAGTCACC
BF428701_cpF1 cgattcgtgggggcatacaa
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01