Query (optional)   in Class  

GrainGenes Probe Report: BF428701-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF428701-6D
Data at Wheat_SNP
BF428701-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;A>C at 986;997
[ Show all 8 ]
Type
EST
SNP
PCR primers
BF428701_cpF1 cgattcgtgggggcatacaa
BF428701D_R1 GAGTCGAACTCTGGTGGGCA
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01