Query (optional)   in Class  

GrainGenes Probe Report: BF428883-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF428883-2D
Data at Wheat_SNP
BF428883-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 24
Reference sequence TGCCGTCTTCTTCAGGTGTTCAGGCACCATGACAAGTACAGAGTGCTCATGTGCACCGACCTGAGCAGGTCAACTACGAGAGCCGGGGTGTACAAGCCGCCGTACGGGGCTTTCGTGGACATGGACATCGAGGCGCACGGCGGGATCGTCTCGCTCAGAACACTGGTAAGTTCATCGCCGCCGTGGCCGCAGCCTGAATCTTTTGCTCTGGTTCAGATACCACCGACTGTAAATCGAGTACTTATTACAACTTGTGATCTGGACGAAC
Type
EST
SNP
PCR primers
BF428883_cpF1 GCCGTCTTCTTCAGGTGTTC
BF428883D_R1 TGGTCAACCTGTTCGTCCAG
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01