Query (optional)   in Class  

GrainGenes Probe Report: BF429186-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF429186-1B
Data at Wheat_SNP
BF429186-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A at 431
SNP C>T at 162
SNP C>G at 16
SNP G>A at 434
Reference sequence GCTTCTCGCTGTCTACTTGACTTCCATTTTGACTGGAGCATGTCCCTTGGTATTCTCTGGCTTGGTTCTTTTTATTGACTTCGCTTTTGTAATTTGCAGAGCCCGCCTTCAAACTCTGCAAGTTCAGATGCTTGCAAACCTCCAGGTATATGAGGAGAGTCCGTTTACTAGTGGTTTGAGAAGGCCTCCGAGTTTAATTCTAGTTTGATGTCACCCTGGATCCTGTCAAGATTGTTGATAGTTTTTTGGCTTGTTGTTCTGTATAAGTAAATGCCGATTCCAAATCATCTTTCCCATTTCAGTTGTATCTTCAGTTCAGCAATCAGCACTGCTTTAAATGGCTTCATCAAGACATTCCTTTTTTCTCTGACATTCCTACTTTTCTTCTATATAGGGGCTCCTGACCCTGAAACTGTGACCCCTGTGGCGCCCCGGCACCCAAAATCATATATGGAGGTTCGCTATCTTGAGCGTCAATTTTTTCTCACAAACTCATGCTAGCATATGAGCAACTTAGTTCAGTCTGAATATGTTGATGTTGAACCGGAAGTTGTCTCTAAACTGTCACTAT
Type
EST
SNP
PCR primers
BF429186A_F1 CATGGACGAAATCGAAGAAACG
BF429186_cpR1 GATATCATCTGGCCGCTCTC
Sequence
NSFT03P2_Contig13696
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01