Query (optional)   in Class  

GrainGenes Probe Report: BF473851-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF473851-2A
Data at Wheat_SNP
BF473851-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 163
Reference sequence TATGAAAACCTCGTCACACTTCTTGGTTGCTGCGCTGAAGGGTCCCATAGGATCCTCGTTTACAACTATCTTGAGAAAAACAGCCTTTCACAGACATTGCTAGGTACTAACACTTTGTCCTGCCGAGCATTTCTGCTGTTCGTCGATTCCTTCATTGGTTGTCATACTTACAGATGTTCTGCATGTGCTATTGCAGGGTCTGGCTACAGCAGCATCCAGTTCAACTGGAGGGCTCGTGTCAAAATTGCCGTGGGCGTTGCCCGCGGACTTGCATTTCTTCATGAGGAAATCCGTCCTCACATCATCCACCGCGACATAAAAGCGAGCAACAA
Type
EST
SNP
PCR primers
BF473851A_F1 ATGAAAACCTCGTCACACTTCTT
BF473851_cpR1 TGTTGCTCGCTTTTATGTCG
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01