Query (optional)   in Class  

GrainGenes Probe Report: BF474340-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF474340-3A
Data at Wheat_SNP
BF474340-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 141
SNP T>C at 112
SNP A>C at 134
Reference sequence TTCATGACCAGCAGAGCGGGTGCACCAATCACCCAACTGCCAGTTAGCATAAGGGAAGCATGACAGCAAAGTGAGATTCTTTGGGTCCTGAAAGTTTGGTGGACTTGATGATCGGTCACCCCAAACATTTGCCACAGAGGTTATCCAGTTCACATGCACCAGCCCCACATCAACATGAGACACAACACCTTCATCTCGGCTGGCCCTCCATGATCCAGACAACCATGTTCCTGACTTGGACACGGAGGGATGAACAATCCTCACGCGTTGAACTTGGATAATAAAAATAAGGTGCATCTTCAAAGATGAATGGAGGAATGGGCTTCAGTACCTCAGAGTCCCTTAACAGCNTTTCACACTTTGCCCCATCACTGAA
Type
EST
SNP
PCR primers
BF474340A_R2 TCATGACCAGCAGAGCGG
BF474340_cpF1 GTTCAGTGATGGGGCAAAGT
Sequence
NSFT03P2_Contig3099
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01