Query (optional)   in Class  

GrainGenes Probe Report: BF474569-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF474569-1A
Data at Wheat_SNP
BF474569-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;A>G;T>A;T>C at 538;866;868;341
SNP C>A;T>C at 538;341
SNP T>C;C>A;T>A;A>G;T>A;T>C at 150;538;734;866;868;341
Reference sequence CCTNTGCTCTTGCTACTGTACCGCAACTAGTTTGTGTACCTGTCAGCCTGCTGGCTGCTCTTGATCTTAGTTTCTTGTCGCGCCCACCAATCCCCCGATCCGTGCAAGATTCCGATCTGTACGAGCCGCGTCGGCGCAAGGGGTAGCAGTTGCTATGATCCTTATGCGTATGTTCGTGCTGATTACTTTGCCTACTCTTGCTTCTTGGAATTAGTAAGTGGGCTGCCTTTTGCTGTACCGGAGCAGCGCAGCAGCAGCATCCTGCTCTGGTCGTAGAATTTGTTTTGACTATNAGGATAGGGGCTAGCGAAGACAGAGCATGGCTTCTTTGGGGAGCGGTTGGCAACTGATGTTCGCTCATCCTGCTCTGTCCATGGGCTTTCCTAGGCGTCGCTTTAGCTCTGGGAGTGAACAGCCGCGCCGATTTTGGTTTGCCGGATGGTGAACTGACCAGCCGATCCTAACTCTGGATCGAACCATTTCTTATTAAGCTCTGGGTCTAACCTGTTTGTTTTGTTAAACATTAGCCTGGATGAACAATAGTAATTTGTTAGCGCTTGCAAATTCAGTTACTACACATGGATCATAGGATTTGCTACACTTACAATTTAAGCTTCAGAGATCCGTTCTGGCAGCCAATAGGTTCATTTTTAATACTCCCTCCATCCCATAATATCCCGCAGGTAATAAGAAGCTAAAAAAATGAAGCCCATGTCTTTGAAATCCAACGATCTTTGTAAACACGAAATAGTTGATAACATAAGTTAGAAAAAAGAAGTTCCAACTCTTTTCAAGCAGTGTTTGTGTTTCTATTGGGCAGAGCAAGAATTTATTGTAAAAAAAGTGCAAATAAAGTTGACTACATATTTGATCCCTCAGTTAACCAAAATTGTAAAAAAATACAATACGTTTTTTACGCTATACTATAGAATACAGCAGTTATGTTCCCTAGAATCAATATACTGTATTCATCAGCTCATCCATCATCGTAGTTAACTAAACGTTGCATGTGCTGATGTGTATGTGATGCTATGAACAGTGTTAAATATGGACACATCAATTAAATAAATTACTAGTTATTCTTGTTCATAGAGCGAATGAACCATGAATGGCATGTGTGATATTCCTTGTTCATGCAGTTTACATGCTCACACCTTGTTTATCTAAATAAAGTTGTTTTACAACTGTGGCCTACTGCTCAGTGCTCACTGTACTCATTCTTTTTCCATCAGCTC
Type
EST
SNP
PCR primers
BF474569_cpR1 TGAAGGGTGAGAGAACTCCGBE518358-1B
PCR_primers
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01