Query (optional)   in Class  

GrainGenes Probe Report: BF474569-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF474569-1D
Data at Wheat_SNP
BF474569-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>C at 538;341
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF474569D_F3 TCTTGCTACTGTACCGCAACTBF485305-1A
PCR_primers
BF474569_cpR1 TGAAGGGTGAGAGAACTCCG
BF474569D_F3 CGTACCAACTCAACCCCTC
Sequence
NSFT03P2_Contig18091
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01