Query (optional)   in Class  

GrainGenes Probe Report: BF474781-2A

Probe
BF474781-2A
Data at Wheat_SNP
BF474781-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>G;T>A;C>G;G>A;T>G at 57;63;124;126;135;180
Reference sequence GGCTGAAGGTACTTGATGTCGAACGTCGGGACGATGATGTTGGTGACGGTGTCGGCGACGGTCACGTCGTTGGTGAGGCTCTTGATCTTGTCGTGCAGGAACTTGCCGTCGTACTTGGGACCCTTCACCGCGCCGAACATGTTCCCCATCGGGGTCAGGAACCCCCACCTGGGCGTGAATCAAAAGCCAC
Type
EST
SNP
Sequence
NSFT03P2_Contig13614
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01