Query (optional)   in Class  

GrainGenes Probe Report: BF474966-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF474966-7A
Data at Wheat_SNP
BF474966-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;A>G at 74;173
SNP C>T at 341
SNP INS at 11,1
Reference sequence GACCTCAAGAAATTCATCCGCGGCCACCGCCAGAACCACGAGAAGATCCCCGCCCACACCGTCAAGGTATATCTCTCATTCCCTCTCTTCGCCGTCTCGCTTCTTTTGTTGTTCGTTTTCCATGCCTTGCACGCGAGGTGTTTGCTTGAATGCACATACAGTGATTGATTCTATGGTGAACTGGTGATCCGTGCGTGCAGATCCTGATGTACCAGCTCTGCAAGGGCGTGGCTTTCTGCCACGGACGCGGTGTCCTGCACCGTGACCTCAAGCCCCACAACCTGCTCATGGACCGCAAGACCATGGCTCTCAAGATCGCCGATCTTGGGCTCAGTCGTGCCTTCACGGTTCCTCTCAAGAAGTACACACACGAGGTACGATTCCTGGTTCTGTTACCAGTATTAGTGCCGGATTGCTGTCTGATTCTGCATCATTCACGC
Reference sequence CTTTGAGAATTAATCCTCTTAGGTAGATATGCTGAATTCCTTGTAAATGGCAGCTGAGTTGATCACTACCACGGCACTTTTCCCTGGAGACTCTGAGGTGCAGCAGCTCCTGCACATTTTCAAGTACAGTACCACACCTGGTCACACTTGCTTGTTTTCTCACTTGGCATCAGTAGGGGATATCAGATGTTGATGGTCTATATTGGTATTGGAATGATAGGTTGCTGGGCACTCCAAATGAGGATGTCTGGCCAGGAGTAGGCAAACTCCCGAACTGGCATGAGTACCCTCAGTGGAACGTCTCAAAGCTGTCTTCTGTAATTCCTAGTCTCGATGCCGATGGTATTGATCTGCTTGAGGTCAGTAATCAAGCATGGGATCCGTGCTACTCTATCCTTGTAGAAAATATAGAAGCAGAGGTGCTCTTGTGAGAATCTGGTGCTAACTTATAGCTGTGATCCTTTGCAGAAAATGCTGCAGTATGAGCCGGCAA
Type
EST
SNP
PCR primers
BF474966_cpF1 TACATGGACACCGACCTCAABE443936-7D
PCR_primers
Sequence
NSFT03P2_Contig10197
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01