Query (optional)   in Class  

GrainGenes Probe Report: BF474966-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF474966-7B
Data at Wheat_SNP
BF474966-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C at 148
SNP G>A;DEL at 18;19
Reference sequence TTTGTTGCTCGTTTTCCATACCTTGCACGCGAGGTGTTTGTTTGAATGCACATACAGTGATTGATTCGGTTTTTGGTGAACTGGTGATCCGTGCTTGCAGATCTTGATGTACCAGCTCTGCAAGGGCGTGGCTTTCTGCCACGGACGAGGTGTCCTGCACCGTGACCTCAAGCCACACAACCTGCTCATGGACCGCAAGACCATGGCTCTCAAGATCGCCGATCTTGGGCTCAGTCGTGCCTTCACGGTTCCTCTCAAGAAGTACACACACGAGGTACGATTCCTGGTTCTGGTACCAGTATTAGTGCAGGATTGCTGTCTGATTCTGCATGATTCCAGTCACTTGATCTGTTCATGACGTCTGAATTCTTTTGCAGATCCTTACTCTGTGGTACAGAGCTCCGGAGGTCCTTCTTGGCGCCACACACTACTCAACGCCGGTTGACATGTGGTCTGTGG
Reference sequence ACTTAACGTTGTAATTAGTAGCATACTTTGAGAATTAATCCTTTTAGGTAGATATGCTGAATTCCTTGTAAATGGCAGCTGAATTGATCACTACCACGGCACTATTCCCTGGAGACTCTGAGGTGCAGCAGCTCCTGCACATTTTCAAGTACAGTACCACACCTTGTCACACTTGCTTGTTTTCTCACTTGGCATCAGTAGGGGATATCGGATGTTGATGGTCTATATTGGTATTTGAATGCTAGGTTGCTGGGCACTCCAAATGAGGATGTCTGGCCAGGAGTAGGCAAACTCCCGAACTGGCATGAATACCCTCAGTGGAACGTCTCAAAGCTGTCTTCTGTAATTCCTAGTCTCGATGCCGATGGTATTGATCTGCTTGAGGTTAGTAATCAATGCATCCATGCTACTTTATCCTTGAAGAAAATATAGAAGCAGAGGTGCTCTTGTGAGAATCTGGTGCTAACTTATAGCTTGGATCCTTTGCAGAAAATGCTGCAGTATGAGCCGGCA
Type
EST
SNP
PCR primers
BF474966B_F3 CGATCTCGGTTCTTTTGTTGC
BF474966_cpR1 AAATATGCAGCCCACAGACC
BF474966_cpR1 TCTTCGCAGAGATTCGCTTTBE493868-7A
PCR_primers
Sequence
NSFT03P2_Contig10197
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01