Query (optional)   in Class  

GrainGenes Probe Report: BF478559-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF478559-3D
Data at Wheat_SNP
BF478559-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;T>C;C>T;A>C;G>A;DEL;C>G;T>C;G>A;T>C;C>T;G>C;C>T;G>A;INS at 8;10;14;15;50;333;706;708;772;790;797;803;806;817;822,1
Reference sequence ACGCAGGGTTCCCCAAAGGCGTCCGTCTCGCCCGCGCCGAGATCGCTGGGCGGCTGCAGGGCTGCCCGCCAGGAATTCGAGGGCGCGACACAGGATCCAAGCGTCTCAGGTACTGCCTGTCAGCTCCCTAACTAACCCTCCCATCAAGGTTTCGTCGCTGACTCGATTTCTGTACCATCGCTGCTGTTACCCGTGTAACCGTGTGAGGAAATCAGATCAGAGTCGCGCAACGATACGGTCACTCTGCCCGACGATGGCAGGAAGCTGGGTAGGATTGAAATGAAGAGAGTACATATCTCTTTGAACTATATGTTCATGTTCAAATGTTGCACGCCCTGTGACTTAAGAAACCCAGTAGTTTGTAATGATATCTAATTGAAACAGGTGGGCACAATGCTCTGATTCTGTCGATTTATGCTCGATTGCAGAGGCTTTAAATTCATCTTAGCAATCCGTGGCAAAATTCAGAAGTAATCACCACCTTCCCCATGTATAGCAGTATAGGCATAGCTAGGATCCTTGTTCTGAACTTCCCACGGTACCAGTTGTTGTTATCAGCAGTTTACTGACGCTGCCATCTCGTCTTCTGAAGTTTCTTCGGCACGCACCCAGTTGGATCTCCTGGAGCAACTGACGTCGTCCTCCACACCTAATGGCACCGGTACCTTCCATACTACAAAATCACCATACTTCCTTCACGTTCCTCATCCCCTCTCTCATTGATAACTAACAGCATTACATCCCCTTATGCTCAGAGAATGACACCGCTACGGAAACCCGTGTGCTCACTACCATCCGTGAGGAGCTGGTAGAGCTGTACGGGACAG
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01