Query (optional)   in Class  

GrainGenes Probe Report: BF478945-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF478945-6A
Data at Wheat_SNP
BF478945-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>T;G>T;T>C;C>A at 164;168;184;270;401
Reference sequence TCGTGGGGTATAATGTGGCCCCTCATTGGCAAGAAAAAGGGGAGTTGGTACCCTGCTTCTCTCCCAGAATCTAGTCTTCATGGGCTGCAGGCTTACAGGGTAAGCACTCTGATCTTGCCACTGTCTTCAGTTTTGTCTAAGCTAAAATCCAGCAATGTTGTCTGAAAAAACCAACAGTTTTGCGACCAAGATTTTTGATTGCTGGTTGCTTTACCATTACAGGTCTTTATATCCATTGCTTTGATTCTTGGGGATGGATTGTATAACTTTGTCAAGGTGCTTATCCGCACAATTGCTGGCTTCATATCAATGGTTCATAAAAATTCAAAAGCCATGCTTCCTGTTTCAGACAATGGCAGCCCCACCGCTGAAGCTATGTCCTTTGATGATGAGCGTCGCACTGAACTATTCCTGAAAGATCAAATCCCCA
Reference sequence GCCCCTCATTGGCAAGAAAAAGGGGAGTTGGTACCCTGCTTCTCTCCCAGAATCTAGTCTTCATGGGCTGCAGGCTTACAGGGTAAGCACTCTGATCTTGCCACTGTCTTCAGTTTTGTCTAAGCTAAAATCCAGCAATGTTGTCTGAAAAAACCAACAGTTTTGCGACCAAGATTTTTGATTGCTGGTTGCTTTACCATTACAGGTCTTTATATCCATTGCTTTGATTCTTGGGGATGGATTGTATAACTTTGTCAAGGTGCTTATCCGCACAATTGCTGGCTTCATATCAATGGTTCATAAAAATTCAATAGC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01