Query (optional)   in Class  

GrainGenes Probe Report: BF482436-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF482436-3A
Data at Wheat_SNP
BF482436-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;T>C;A>T;G>T;C>G;A>C;T>A at 13;26;29;672;673;674;685
Reference sequence CTGACATCACATAGTATTTTTCATGTAGAAAAAGAGAACTTTTCATATTACAACCTTAATAATTCCAAAGCAGAAATCTACATCTGATTCGGTAAGTTGTTCTTGTATCTTTCGTTGACTAGGTTGTTTACTGTATTAATAATACATTGCTTTCTTTTTTGACAGTGTGAAGCTACAAATGAAGAAGAACTATTTGAAGTTCAGGACAAGGGCTCACTATTCACCCTTGGTTGGATTCATGTAAGTTCAGTTTAAAGAATTTTATGCACCATTGATGCTGTTTGTTGTTTGCTCAAGCCAATAAGGTATATGTAATCTGTTAACAATATATTTAAAGATATATCAATTAATACGTTTTCTTTAGTTCTTTGTCTTCATAATTCATAACTGAAGAAACTCTGTTTAAAACCTTTGTTGTTACAAAGCTGGATACTATGCTATCAAACCCTTTTGCTTGAATTGGCGTGCCACTTTTATTTTGAGAATCTCGCTGATATGCTTACAATTGTCACCTTGAAATCGACATTTGTCCATGTAATTACGTGTATTACATGATTTAGATCCATGTTGCCTAATTGTGGACAATGCTTCATGCACTTCCCATACACAATGGAAGGTGGTGCGGTGCCACAAGGGCATCTTCCATAGTTGATAGGTGAAATCATGGTTTTGCAACTAGATCTGTATGTATATGTATTGCTTTCTTGCA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01