Query (optional)   in Class  

GrainGenes Probe Report: BF482960-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF482960-4B
Data at Wheat_SNP
BF482960-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;G>A;C>T;G>C;A>G;T>A at 75;165;504;667;802;840
[ Show all 7 ]
Type
EST
SNP
PCR primers
BF482960B_F1 CGTGACTTTCCCTTTCATACC
BF482960_cpR1 CTATCTGCCCAAAACCTCCA
Sequence
NSFT03P2_Contig2129
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01