Query (optional)   in Class  

GrainGenes Probe Report: BF482977-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF482977-3D
Data at Wheat_SNP
BF482977-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 745
SNP C>T at 257
SNP G>A at 205
Reference sequence ACTGTCCCATACACAAGCATTGTGAGAGACGCCACAGCCTTCCTATTAGGGATGTTTATGGCTTTATGCCGGAGAGGTTGATCCGCCACTCCTCCTTGGCGGAGCGCTCCAAGTGCCACAAGGATTGGTCCCAAGATGAAGCCACTCCTTGACTAAGTTCCAAAGCCGAAGCATGAAGCGGTACTTGAAGAAGAGATGCACCCCGGATTCATGCTCCCTTTTGCAAAGAGGGCAAAGACTGCAATTTGGCCACTCACGTTTGGTCAATCGATCGGCGGCCCAAACCCTATCTTGAATAGCCAACCACGAGTCCTAAAGTAACAGAAACCTCTCTTGTAATACAAACAAAACTATATTTATACTACATGCTCAACAGTGCCAACTGCCATGCAAATGACGGTTGCATCCATGTGGTATATCCTACTATCCATAACATTAGAAGAAAGTCAAAAAGCAATAGAGGGATTGTGTACTAGATTACCAGAACCAGAACCAGATGCGTGTCTTGTACTGTTGTACATGTTGATGAAGATGAACTAATGCTATGAGAGGATTATTAGGGTTAGCTTCTTATTACATGTTTCTTGTATGTCCCAGATTGCAAACATGATTAGGTTTCTGGTGGATAGCTACAACAAGCCAATCCCTGCGATATTGGAAATTCCATCCAAGGACCATCCATATGATCCAGCGAGTGACTCGGTCCTTTCTCGTGTGAAGTATCTGTTTTCTGCTGACTCGGTTGCT
Reference sequence TTGCTATAATGCATATCTTTCTTTTCTCTTAAGAATCAGCAAATTGTTTTGTCAGAATCTTGCAAGTATATCACGTAAAGAAAGAGGGTGGTCATGAGTGTTTGGGGTTAAGTAGTCCTGATTAGTTTCTTTAGACTCAGCTCCTTCTGCTGTAAACAAAATAGACGAGGCCGTTGAAACTCAAAATAGGCGGAGGGGCGCTCTTTTGATAGAAGACACGGGCGTTCCTCTCGTTCCAAACTGTCCAATACACAAGCATTGTGAGAGACGCCACAGCCTTCCTATTAGGGATGTTTATGGCTTTATGCCGGAGAGGTTGATCCGCCACTCCTCCTTGGCGGAGCGCTCCAAGTGCCACAAGGATTGGTCCCAAGATGAAGCCACTCCTTGACTAAGTTCCAAAGCCGAAGCATGAAGCGGTACTTGAAGAAGAGATGCACCCCGGATTCATGCTCCCTTTTGCAAAGAGGGCAAAGACTGCAATTTGGCCACTCACGTTTGGTCAATCGATCGGCGGCCCAAACCCTATCTTGAATAGCCAACCACGAGTCCTAAAGTAACAGAAACCTCTCTTGTAATACAAACAAAACTATATTTATACTACATGCTCAACAGTGCCAACTGCCATGCAATGACGGTTGCATCCATGTGGTATATCCTACTATCCATAACATTAGAAGAAAGTCAAAAAGCAATAGAGGGATTGTGTACTAGATTACCAGAACCAGAACCAGATGCGTGTCTGGTACTGTTGTACATGTTGATGAAGATGAACTAATGCTATGAGAGGATTATTAGGGTTAGCTTCTTATTACATGTTTCTTGTATGTCCCAG
Type
EST
SNP
PCR primers
BF482977_cpR1 GCCTATCAGAAGCAACCGAG
BF482977D_F3 CTCGTTCCAAACTGTCCCAT
Sequence
NSFT03P2_Contig17227
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01