Query (optional)   in Class  

GrainGenes Probe Report: BF483091-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483091-6A
Data at Wheat_SNP
BF483091-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;T>C;G>T;T>A;T>C;A>G;T>C at 224;233;341;359;472;534;552
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF483091A_F1_UCD GCAAAAAATATCTGTTAGAACAAGACTG
BF483091_cpR1_UCD CACCATTGCCATCACAAGAG
Sequence
NSFT03P2_Contig2220
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01