Query (optional)   in Class  

GrainGenes Probe Report: BF483299-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483299-3A
Data at Wheat_SNP
BF483299-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;A>G;C>T;A>T;C>A;A>G;G>A;T>A;T>A;G>A;C>T;C>T;A>G;C>T;C>T;G>T;A>G;T>C;A>G;C>G;G>A at 77;87;94;101;113;115;121;126;127;134;137;161;162;163;165;197;199;216;223;234;240
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF483299A_F1 TTGGCCACTCTATGGGAAGT
BF483299_cpR1 GACCCCAAGGGCAGTTTATT
Sequence
WHE1791_B11_C21ZS
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01