Query (optional)   in Class  

GrainGenes Probe Report: BF483299-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483299-3B
Data at Wheat_SNP
BF483299-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 24,1
SNP C>T;T>C;T>C;T>C;G>A;A>G;C>T;T>C;T>A;T>C;C>G at 45;53;54;60;61;72;76;86;93;124;142
SNP C>T;T>C;G>A;C>T;T>C;T>A;T>C;C>G at 45;60;61;76;86;93;124;142
Reference sequence CGACGCCAGTGAGATTTGAAGAAATAATAACAAGAGAGTACAGATATTGTGTGAAGTAGATGCCTACAAGTTTCCTAATCTGAAAAAAGGTTCATAGACAGGAATTTCCAGATGCAGAGGGTTTAACAAATAGCGTCAAATAGTACCTTGTATTTGTCAGTGTTCTTCAAGTAGATAGTCAGTGCACCGTGCCCTCCCATAGAGTGGCCAAAAATTGATGCACATGACGTGTTAAGCTGTTCAAAGTTGTCAGTTAAAACTTTTGGCAGCTCCTTCACAACATAATCATACATGCGCCAGTTTTTCCACTTCTCATTTGTGGCAT
Reference sequence CCTCTGCATCCTGGAAATTCCTATCTATGAACCTTTTTTCAGATCAGGAAACTTGTAGGTGTCTACTTCACACAACATCTGTACTTTCTTGTTATTACTTCCATGAAATCTCACTTGGCATTGTGAATTTATCTTACCTATCCAGTCGGTGTCTGCATTTGCTCCAATTGCTAACCCAATAAACTGCCCTTGGGGTCA
Type
EST
SNP
PCR primers
BF483299B_F1 CCTCTGCATCTGGAAATTCCTA
BF483299_cpR1 GACCCCAAGGGCAGTTTATT
Sequence
WHE1791_B11_C21ZS
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01