Query (optional)   in Class  

GrainGenes Probe Report: BF483299-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483299-3D
Data at Wheat_SNP
BF483299-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T at 113
SNP A>T at 100
Reference sequence TTGAATGCCACAAATGAGAAGTGGAAAAACTGGCGCATGTATGATTATGTTGTGAAGGAGCTGCCAAAAGTTTTAACTGACAACTTTGAACAGCTTAACACGTCATGTGCATCAATTTTTGGCCACTCTATGGGAGGGCACGGTGCACTGACTATCTACTTGAAGAACACTGACAAATACAAGGTACTATTTGACGATATTTGTTAAACCCTCTGCATCTGGAAATTCCTGTCGATGAACCTTTTTTCAGATTAGGAAACTTGTAGGCATCTACTTCACACAATATCTGTACTCTCTTGTAATTACTTCCATGAAATCTCACTTGGCATTGCGAATTTATCTTACCTATGCAGTCGGTGTCTGCATTTGCTCCAATTGCTAACCCAATAAAC
Reference sequence TTTGGATTTTATTTTGAATGCCACAAATGAGAAGTGGAAAAACTGGCGCATGTATGATTATGTTGTGAAGGAGCTGCCAAAAGTTTTAACTGACAACTTTGAACAGCTTAACACGTCATGTGCATCAATTTTTGGCCACTCTATGGGAGGGCACGGTGCACTGACTATCTACTTGAAGAACACTGACAAATACAAGGTACTATTTGACGATATTTGTTAAACCCTCTGCATCTGGAAATTCCTGTCGAGGAACCTTTTTTCCAGATTAGGAA
Type
EST
SNP
PCR primers
BF483299_cpF1 TGGATTTTATTTGAATGCCACA
BF483299D_R1 TCCTAATCTGAAAAAAGGTTCCTC
Sequence
NSFT03P2_Contig17868
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01