Query (optional)   in Class  

GrainGenes Probe Report: BF483498-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483498-3A
Data at Wheat_SNP
BF483498-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;C>G;T>A;A>C at 48;109;863;864
Reference sequence TTTCAGGTTTTTGCCCCTTCTTTTTTCTGATGACGGTCTTGATAGCTTGATTTAATAGCCTTATACTGTACATCCGCATGTTGTGCAAAAGCACATTTCAGTTTACTACGTATGCGTATGTACAATGTAGGGAAAATGTATGATGCATTTATCTCAAATTGGTAGAGTAATACTTATTTATAGTAGCAGAGGGGCCATTTCTGGTTGGTGTCTAAACACTGTCTGTTCTGTCGCTTTTTATTTTCAATTGGATGATCATGGTTTGAGCATAAATGAAACTGCAGCATCTGATCACCATTTTGAAATTGCTAGGTTAAGACAACTTCCCCTAAAAGATATTGCGTCCGACCAAATATTGGAGTTATCCTTCCAAGGGCAACATGTGATTTCACAGGTGTGTACACTACTGCTACTGACCTTATTGATACCTTATAGTGATAGACAACTTGTTGAGTTTTAACCACTCTCTAAAGCTGAATTGCTTTTTACTCGTTCTATATTTATGTAAGTGGGCTCATTCTTAGTTAAGTTGCTTTCTCATCTTCTTTTTTGGTTTGTGGAATGAACTAAGTTGGTCCATTGCCACCTCGTTCCTCATAAGCACAACACTTTAAAAAAATGAGGAAACGGGTCATCCCACAAAAATCATAGCATGAACACTCATGATGGACCAACCCATCTGTTCCTTAAAGCAAACATGTCATAATGTGCTTGCTTCAGAGAGAGGGTAGCAATTATATAATTTTGTTTGTCTTGCATTCAACTATTCATGCCTTGATTCTGTTTGGTTTCTTCGGTTATATTCCTCTTGATTTGTATATTTTTATCGCCTCTTAAATGCAGTTACCATGCAAGCACAGCGTATGCGCCACCAGAC
Type
EST
SNP
Sequence
NSFT03P2_Contig16795
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01