Query (optional)   in Class  

GrainGenes Probe Report: BF483498-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483498-3D
Data at Wheat_SNP
BF483498-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;C>T;T>C;G>A;C>G;C>T;DEL at 124;129;392;410;701;868;605
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF483498_cpR1 ACCAGGAGGAACAACTGTGG
BF483498D_F1 CCTTCTTTTTTCCGATGACAA
Sequence
NSFT03P2_Contig16795
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01