Query (optional)   in Class  

GrainGenes Probe Report: BF483551-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483551-4A
Data at Wheat_SNP
BF483551-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;A>G at 251;430
SNP G>A;A>G;C>T;G>A;G>C;C>A at 203;240;520;558;672;673
Reference sequence ACAAACCTGAGATCGAGCAACTCATATTCTGGTGTCAGTACTGGTAAGGTGGCTCCTTCAGTTATATGATTATTAGAAGTTCACAGCATTAGCCTAGGGGAATAATTTGCAAATTTTGTTATGTTTCTTGTGTCTAGGATTTTAGTTGCCCTTATGACGGTTATGGAGAGGTTTGGAGATTTAACAATATCATGGTAAGAACGCCAAGGATTGCACTCTTTCATCAGCTCTTTGGACAAATCCCTAACATCAGTTTTATCATGTTGAAGGCTACCATTTTACTCAGAGGCAAAGCTGCTGTTCTTTATATACTTGTGGTACCCCAGGACAAAGGTACTCGATTTGTCCCTTGCAACTTCTATTTTGCGTATTTCTCTGCACATTTAACTGATCTGTGCTTTCATTGCAGGGGACTACCTACATTTATGGAACTTTCTTTAAACCATACATTTCACAGCATGAGAATGAAATTGACCGGAATTTGCTTGAGTTGAGAGCTCGGGCCAGCGATGTTGTTGTCGTTTATGTCCAGAAGGTTGCTGCTGTTGGACAGAAACGACAACAACATCGCTGGCCCGAGCTCTCAACTCAAGCAAATTCCGGTCAATTTCATTCTCATGCTGTGAAATGTATGGTTTAAAGAAAGTTCCATAAATGTAGGTAGTCCCCTGGCATGAAAGCACAGATCAGTTAAATGTGCAGAGAAATACGC
Reference sequence TAGCCTTCAACATGATAAAACTGATGTTAGGGACTTGTCCAAAGAGCTGATGAAAGAGTGCAATCCTTGGTGTTCTTACCATGATATTGTTAAATCTCCAAACCTCTCCATAACCGTCATAAGGGCAACTAAAATCCTAGACACAAGAAACATAACAAACCTGAGATCGAGCAACTCATATTCTGGTGTCAGTACTGGTAAGGTGGCTCCTTCAGTTATATGATTATTAGAAGTTCACAGCATTAGCCTAGGGGAATAATTTGCAAATTTTGTTATGTTTCTTGTGTCTAGGATTTTAGTTGCCCTTATGACGGTTATGGAGAGGTTTGGAGATTTAACAATATCATGGTAAGAACACCAAGGATTGCACTCTTTCATCAGCTCTTTGGACAAGTCCCTAACATCAGTTTTATCATGTTGAAGGCTACCATTTTACTCAGAGGCAAAGCTGCTGTTCTTTATATACTTGTGGTACCCCAGGACAAAGGTACTCGATTTGTCCCTTGCAACTTCTATTTTGCATATTTCTCTGCACATTTAACTGATCTGTGCTTTCATTGCAGGGGACTACCTACATTTATGGAACTTTCTTTAAACCATACATTTCACAGCATGAGAATGAAATTGACCGGAATTTGCTTGAG
Type
EST
SNP
PCR primers
BF483551A_R1 GAGCTCTCAACTCAAGCAAATTC
BF483551_cpF1 AACAAACCTGAGATCGAGCAA
Sequence
NSFT03P2_Contig11296
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01