Query (optional)   in Class  

GrainGenes Probe Report: BF483551-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483551-4B
Data at Wheat_SNP
BF483551-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 13
SNP T>G at 121
SNP T>A at 277
Reference sequence TGATTACAGTTCACAGCATTAGCCTAGGGGAATAATTTGCAAATTTTGCCATGTTTCTTGTTTCTAGGATTTTAGTTGCCCTTATGACGGTTATGGAGAGGTTTGGAGATTTTACAATATCATGGTAAGACTACCAAAGATTGCATTCTTTCATCAGCTCTTTGGACAAGTCCCTAACATCAGTTTTATCATGCTGAAGGCTACCATTTTACTCAGAGGCAAAGCTGCTGTTCTTTATATACTTGTGGTACCCCAGGACAAAGGTACTCGATCTGTCCCTTGCAACTTCTATTTTGCATATTTCTCTGCACATTTATCTGATCTGTGCTTTCATTGCAGGGGACTACCTACATTTATGGAACTTTCTTTAAACCATACATTTCACAGCATGAGAATGAAATTGACCGTAATTTGCTTGAGTTGAGAGCTCGGGCCAGCGATGTTGTTGTCGTTTATGTCCAGAAGGTTGCTGCTGTTGGACAGAA
Reference sequence AAATCTCCAAACCTCTCCATAACCGTCATAAGGGCAACTAAAATCCTAGACACAAGAAACATAACAAACCTGAGATCGAGCAACTCATATTCTGGTGTCAGTACTGGTAAGGTGGCTCCTTCAGTTATATGATTACAAGTTCACAGCATTAGCCTAGGGGAATAATTTGCAAATTTTGTTATGTTTCTTGTGTCTAGGATTTTAGTTGCCCTTATGACGGTTATGGAGAGGTTTGGAGATTTAACAATATCATGGTAAGACTACCAAGGATTGCATTCTTTCATCAGCTCTTTGGACAAGTCCCTAACATCAGTTTTATCATGTTGAAGGCTACCATTTTACTCAGAGGCAAAGCTGCTGTTCTTTATATACTTGTGGTACCCCAGGACAAAGGTACTCGATCTGTCCCTTGCAACTTCTATTTTGCATATTTCTCTGCACATTTATCTGATCTGTGC
Type
EST
SNP
PCR primers
BF483551B_R1 GCAATGAAAGCACAGATCAGA
BF483551_cpF1 AACAAACCTGAGATCGAGCAA
Sequence
NSFT03P2_Contig11296
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01