Query (optional)   in Class  

GrainGenes Probe Report: BF483588-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF483588-1B
Data at Wheat_SNP
BF483588-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;A>C;A>G at 59;186;425
SNP A>T at 186
SNP T>A;A>C;A>G at 59;186;562
Reference sequence TCATCCATCAACAACCTGATTCAGCCTGCAAGGATGAAGAAAGCAGAGCATTTGGAGCTGTCAGTCAGCCACCATTGTTTCAGGGTTCAGGACCATCTTCCACTCCCAACCTTCAACAGTATCTGCACTAACCATACCTCTGATCATCTGAGGAAGGTGCAGCATGATCCTCCTCCTCGGCCTTGATGGGCTCCGGATCGACGACCGGGGGCGGCGCGAAGGCGCAGATGAACTGGGAGAGCAGAGGGTCGGGAGAATGGTCATCGGGAACCGGCCGGCCCATGATGTATGAGGATTCCTCAAAGTAGGAGTCCTCATCTTCATATGCCTCCTTGTCATCAGCTGCTGCTCCTGCCCTGGAAGAAGAGGACTTCCTCATCTGTGATCAAAATGGCATTGCCAGTGAGCTGCAATGTGGTTTGCAAGATGCAATGCCTGTCCATGACACTAGTGCCAGTGATGGTGAAGTTTTATTGTACCTTGAGTTGTTGAGAGTGTTGCTCCCTGAAATGCCCCATCCGTGTCGGCCCCGAGGTTCTCGGCGCAGATCGGGCTCCCCTGAAAGAAGAAGAAGAAGAAGCCACTGAATCACCAAAGAGGAATTTGTACCTCAAGGGTAGCCACTGAA
Type
EST
SNP
PCR primers
BF483588B_R1 CGGTGATTCAGTGGCTACC
BF483588_cpF1 GACGCATCATCCATCACAAC
Sequence
NSFT03P2_Contig3431
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01