Query (optional)   in Class  

GrainGenes Probe Report: BF484028-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF484028-5D
Data at Wheat_SNP
BF484028-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>C at 214;412
Reference sequence TGCCAACCAGAGCATGTTGTGTTGTGGTAGAGTATCTCGCTGGAGGCACTTTGAAGCAGTACCTGATAAAGAACAGACGGCGGAAGCTCGCCTACAAAGTTGTGGTTCAGCTTGCATTGGATCTGTCCAGAGGGTAATATGCTCTTCAGCTCAAATCACCGCTATGCATTATTTCTAGAGTATCCGAGTCCAAAAAGTAATAGTCTGGCACTTTCCTTTTGCAGATTGAGCTATCTACACTCGAGAAAGATAGTACATCGCGACGTGAAAACTGAAAATATGCTGCTTGACACACAGCGTAACCTTAAGATTGCTGATTTTGGCGTTGCACGTGTTGAGGCTCAGAACCCGAAGGATATGACTGGTGCGACAGGCACTCTTGGTTATATGGCCCCAGAGGTATTTATTGGAGTGACCTCTTTTAAGTTTGTTCCTTCACAAAATGGCGTCCTACTTAAAACAAAATCTCCTGTTCTTCCTTGTATGCATTTACAGGTTCTTGATGGTAAACCATACAACAGGAAATGTGATGTTTACAGTTTTGGCATTTGCTTGTGGGAAATCTATTGCTGTGACATGC
Type
EST
SNP
PCR primers
BF484028D_F1 GCGTGCCAACTTGCCAACCBE405849-5D
PCR_primers
Sequence
NSFT03P2_Contig13501
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01