Query (optional)   in Class  

GrainGenes Probe Report: BF484270-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF484270-2D
Data at Wheat_SNP
BF484270-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 317
SNP A>T at 326
SNP DEL;A>G;T>C at 32;317;444
SNP A>G;T>C at 317;444
Reference sequence TCACGAGGACGGGTTTAGCGATTCGTGGTCTCTAGGACTTACCATGAAGTGAGCGATTGAAGCTTAATTTTGGGTTGCCATGAACTGAACAATTGCATACTGCGTGTTCTTCAGTCATTAGCATGCTATATAAGGTGTTTCTTAAGGCCAAAGTAAATCAATAACCAATTCGTTTCAGAAACGAGAGATATTTCAAGACCTGGCCCCGCTTCTCTGGCACTCTTTTGGCACAATTGCGGCACTGCTTCAGGTATGCGTAATTCGTCTATCTTCTATGTTTATGGTTTGCATGCTTCAAATTACATAAAAGAACTGGAAGCTATGTACCTTATGCTGTGTTTATATTGTCGAACTGTGAAAGCAGTCACTATTCTATTAGTGTTTTCAAGTCGGCACTTGCTGTTTTCGATGCAACTTGTCAAAGTTTGACCCTGCCTTGCTCATTTGGTGTATTTGACAACTTGGAAACAAACTCAGGAAATTGTGTCGATCTACCCT
Type
EST
SNP
PCR primers
BF484270_cpR1 GGGTGAAAGTGCAGGGTAGA
BF484270D_F3 TCACGAGGACGGGTTTAGC
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01