Query (optional)   in Class  

GrainGenes Probe Report: BF484342-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF484342-7A
Data at Wheat_SNP
BF484342-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 357
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF484342A_F2 ATACCACAGATACCGGACAA
BF484342_cpR1 AGCGCTTCAGCATTTTTGTT
Sequence
NSFT03P2_Contig2674
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01