Query (optional)   in Class  

GrainGenes Probe Report: BF484342-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF484342-7D
Data at Wheat_SNP
BF484342-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;C>T at 67;585
Reference sequence AGGGCAAAAAGAGGTATATATTGGTCCTACTTTCTAGTCTGATTCCATTACATGGATTGTGATTGACATTCAGTCTCTTATTTCTATTAGGCCTAGATGGGCGCTTGTCGATAAAGCACACTTGCATAATACGTGGAGATGTTCACAATCATCATACCACAGATACCGTACAGATGCCAATGTATCTCCATCTAGCCTCATGGTTAATTTGGTGAAGGATCTCCTAGATCTCTCACTACACAACTATGAAACTGTTCGCTCGTAAGCTCTCTTTCCCTCTTTATTTACATGTGACCATATAGCTTGCAACTTCTGTTTAGGCTGTTAGTATGTATTTTCGTTCGAATATTACCACCAGCATTTGCAATACATAGTAACTCGAGAAACTGTTGATTCTGACTACTGTATGTTTCTGTTTTTCTCTGTTTTTGGAATATAACAACGCACAGTTGTGGATATTGATTTGTTTGTAGTTTTCTTTATCTGGCTGATATTGATCATGACCTCATAGCAGAAATGAAGTTTCAATCAAAGGGTTATGTGGTCATACATCAGTGACCTACTTTACTTTGTTACCATGTTTCCAGGTATGCTGGAAGATCGCTAACAA
Type
EST
SNP
Sequence
NSFT03P2_Contig2674
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01