Query (optional)   in Class  

GrainGenes Probe Report: BF484606-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF484606-1B
Data at Wheat_SNP
BF484606-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;INS at 252;134,1
SNP T>A at 2
SNP INS at 134,1
Reference sequence ATGTCGGCGAGTCTCCTGGACACTATGTTTTTCCTGGAGGACATTCTGAGGTAATATCTTAAGAATGTTACAATATTGAGCACAGCTAATGACATCTAAAGTTTTTGTTCAAAGAGGCCCCAAGTAGAGACAAAGCTCTAGGACGTGTAACTTTGGTAGGCTGGACTGTTTAGTTTAACTCGTTTTTCTTTGCTAGAGATCAGCATTCATGTGGAAAGTGCTTGTCTTTTGTTCCTCTTTTACTTTGTAGATATATCATAGTTTCGTCCAATGAGAATTGGGGCCACCCATTACTTGAAAAACAAAATGCTCTAGGCATAGTCACTCTTTTTCTTTCAGATGCCGAACAAATTTACTAGAGGAGTAATGTATACTTGATAATTTAAAACTTGGAAAATGTTGACTTAAGACAACAATTGAAATTCTCGAAATGGATATATTTTATTTAGCAGGACTGGTGGGATTGTGGTTCGAGTGGTCGATCTGTAATATTCATGTTTCTTATTATCCAAGTTCAATTGTTTGTATCAGCCACAAGAAGTTGGAATCTTGGCTCATCAAAATGACGAAAAGATGTTGCTGGTCTCACTGAAAGAATTTCTGATGAAATGTTTGA
Reference sequence GACCTGTAAGGTTTTTGTCTAAAGAGATCCCAAGTAGAGACAAAGCTCTAGGACATGTAACTTTGCTAGGCTGGACTGTTTAGTTTAACTCGTCTTTCTTTGCTAGAGATCAGCATTCATGTGGACAGTGCTTGTTTTTTTGTTTGTCATAACTTTCTAAATATAATAGTTTCATCCAATGAGAATTGGGGCCACCCATTACTGAAACACAAAATGCTCTTGGTATAGTCACTCATTTTTCTTTCAGATGACGAATAAATTTCCTAGTAATGCATACTTTATAATTTGGAACATGGAAAATGTTGACCTAAGACAACAATTGAAATTCTTGAAGCAGTTATAATTTATTTAGAAGCAGTTGTGGTTCGAGTGGTCGATCTGTTGTCTTGATGTTTCTCATTATCCAAGTTCAATTGTTTGTATCAGCCACAAGAAGTTGGAATCTTGGCTCATCAAAATGAAGAAAAAGATGTCAGTGGTCTCATTGAAAGAATTTCAAATGAAATGTTTGATGACCC
Type
EST
SNP
PCR primers
BF484606B_F1 TTGAGCACAGTTGATGACCTG
BF484606_cpR1 TCACGGATGATTCCATCAAA
Sequence
NSFT03P2_Contig13491
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01