Query (optional)   in Class  

GrainGenes Probe Report: BF485004

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BF485004
Locus
Sr35
XBF485004
Reference
ReferenceZhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474.
ReferenceZhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Type
Indel
PCR
PCR primers
BE485004-F TGCAGAATGCGTTCCTTCTA
BE485004-R GGCCAGAGAATTTCTTGAGG
Amplification Conditions
Touch down from 63°C to 59°C (9 cycles of 20 sec, -0.5°C each) Amplification at 58°C (34 cycles of 20 sec each)

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.