Query (optional)   in Class  

GrainGenes Probe Report: BF485305-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF485305-1A
Data at Wheat_SNP
BF485305-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 18,1
Reference sequence TGAGTTCCTCAGTTTCAACTATGGAAATGCTCATACTCATACAGTGGTCAGTAGTGAAGAAGCTGCTCCTAGTGAAGAGCTCATGCAACCTCCCCGAGGAGCCCGCGAGAAGGAACTGCTACAGGTTGCGTCCTCTTCTCATGCTTGATTGTATTGTACTGTCCTAACCACATCCCTATAGTGGTGACCATTTATGTCGTTCATGCAGGCGGTCAATCAACTCGGTGACGCTAATGAGGTTTTAAACGAGCGTGCTGTAGCTGTCATGGCACGGATGAGTCACAAGCTAACAGGGCGTGACTTTTCTTCTGGATCAGCCTTGTCAGGCGCCGGCGGCTCAAGTCAACATGGCAGTGAACATTTAGCCTCAGTA
Type
EST
SNP
PCR primers
BF485305_cpR1 CTCCCGAGCATCTACTGAGGBE405518-1A
PCR_primers
Sequence
NSFT03P2_Contig17420
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01