Query (optional)   in Class  

GrainGenes Probe Report: BF485305-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF485305-1D
Data at Wheat_SNP
BF485305-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 29
SNP C>T;C>T at 29;164
SNP G>A at 42
Reference sequence ACTGAGGCTAAATGTTCACTGCCATGTTGACTTGAGCCGCCGGCGCCTGACAAGGCTGATCCAGAAGAAAAGTCACGCCCTGTTAGCTTGTGACTCATCCGTGCCATGACAGCTACAGCACGCTCGTTTAAAACCTCATTAGCGTCACCGAGTTGATTGACCGCCTGCATGAACGACATAAATGGTCACCACTATAGGGATGTGGTTAGGACAGTACAATACAATCAAGCATGAGAAAAGGACGCAACCTGTAGCAGTTCCTTCTCGCGGGCTCCTCGAGGAGGCTGCATGAGCTCTTCACTAGGAGCAGCTTCTTCACTACTGACCACTGTATGAGTATGAGCATTTCCATAGTTTGAAACTTGAGGAACTTCATTGAAATTGAACAAACGCCAATTGATCAGCGGGTCATGTACAA
Reference sequence GGTTGCGTCCTCTTCTCATGCTTGATTGCATTGTACTGTCCTAACCACATCCCTATAGTGGTGACCATTTATGTCGTTCATGCAGGCGGTCAATCAACTCGGTGACGCTAATGAGGTTTTAAACGAGCGTGCTGTAGCTGTCATGGCACGGATGAGTCACAAGCTAACAGGGCGTGACTTTTCTTCTGGATCAGCCTTGTCAGGCGCCGGCGGCTCAAGTCAACATGGCAGTGAACATTTAGCCTCAGTAGATGCCTCGGGA
Type
EST
SNP
Sequence
NSFT03P2_Contig17420
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01