Query (optional)   in Class  

GrainGenes Probe Report: BF485380-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF485380-7B
Data at Wheat_SNP
BF485380-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 375
SNP INS;DEL;C>T;DEL at 151,12;62-66;479;290-296
SNP C>T at 479
Reference sequence GGCGGAACGGCTGACAGTTTTCAGGGAATGATATAATGCTTTGGCGATAGATGAGTTTGCGCACTGTCATATTTTTTTAATTACAATCGAGTTTTCAGGTAGCAAATGATGCTTGGATTATACAGGTTCTAGAATTCTAGCTGCTTATGCAGGCTATCCACTAGTATTATTTTTTTATGGAGATTTTTGTTGTCATGCTACAATTCATGTATATAATTCTGGTATCCATCTATGGATGCATTTTTGTTTAACATAAAATATAAATCTGGGTGCATTCTAGCACGGCTGGTCATCCCTCGGTGAACTCTATCTTGTGTAATCCTGTCATCAGCTGCATACTAACTAGTAGCTGGATACATGTCCAAAATATTTTAATGTCTATAATACAGCAAAATATGTGGCCAATTTACTGAATCTGAACTTTGTGTTCCGGCCCACTGGGACAAGCCATGAAGTACCTCTAGAATTGCTTACTTTCCTGACTTGCTTTTGATAAACACATCACCTAAGCATGGTTATGTACCCTTTGCATTAATAAATTTGTTACTCTCTGCCTGTGCTGATACAAT
Type
EST
SNP
PCR primers
BF485380B_F3 CGAATTGCACGTTTACGTGA
BF485380_cpR1 ggcttccttgcaacccatacact
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01