Query (optional)   in Class  

GrainGenes Probe Report: BG123

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG123  [ Marker Report ]
Locus
Xbg123-2
[ Show all 8 ]
External Databases
DDBJ
EMBL
GenBank
Reference
ReferenceHeun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks
CSU barley gDNA
Type
Genomic
STS
PCR primers
TCC AAG AAG AGT CAA GTA AA
CAA GCA GTA GGA ATA AGA AC
STS primers
5' CTGTGATTGACATGCCATTGC
5' TCGTTTACATCCCTCATTAGG
STS size
310
Amplification Conditions
STS annealing temperature 52-55 oC
Sequence
BG123
Linkage Group
2L & Group 7
2
Source Species
Hordeum vulgare
Insert Size
1.6
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
Lapitan, Nora
Kleinhofs, Andris
Clone Authority
Lapitan, Nora
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03