Query (optional)   in Class  

GrainGenes Probe Report: BG262960-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG262960-7A
Data at Wheat_SNP
BG262960-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;T>C at 447;496
SNP G>A;T>C at 465;496
SNP INS at 419,1
Reference sequence GTTGGGTCCTCGTAGCAACATTGGAATCAGGAGGATGGGTCAAGTGGATGAGAAGCCGTTTATTGAAGCTTGCAAGCCAAAGTATGGCGCGGAGGCGGATACAAAAGCTCTTGAATTTTGCTCCATGTGGCAAGACAATCTGAGGGATGCTAATTGGCACCCTTTTAAGATAGTGACCACAGGTGAAAAGTCTGAGGTATGAACAATCAATGGAGTGATTCTTATCTTGTTGCCTTCCTGTCTTAAGCAAATACTACCTCCGTCCTGGTTTATTGGTCCCTATTGTATTTTGTGTCAAATTTTGATCATAAATTTAACTAACAAAATGTTCATGCATGTCACGAAAAGTTATATCCTTCAAAACTATGTTCAAATACGAATCCAATGGTATATTTTTTGTTGACATGCATTGACACTTTGCTAGTTAAATCTTTTGGTCAAAATTTGGCACAAATTACAAAGGGGATCAATAAACCAGGACGGAGGTAGTACTCGTTGACAAGTACTTATTGCAATGATCAACACTTGCTGACAAGTACATATTGCAATGATCAACACTTGCTGACAAGTACATATTTGCAATGATCAACAATAACATGATGTGATGTGTCCCCCAGCAAATCATCGACGAAGGCGACGAGAAGCTGGTGGGGTTGAAGGAGGAGCTGGGCGAA
Type
EST
SNP
PCR primers
BG262960A_F3 GCTTGGTCGATCTGTTGGGT
BG262960_cpR1 CTTGTAAACCTCTTCGCCCA
Sequence
NSFT03P2_Contig14052
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01