Query (optional)   in Class  

GrainGenes Probe Report: BG263233-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG263233-1A
Data at Wheat_SNP
BG263233-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 836
SNP C>G at 484
Reference sequence TTGTCATTCTTGCAAGGGCAGCACATTGTGATTCTGCTTCACAAGGAGCCTATTGCNCTGGTACAGGAGAGGGAACTTTAAGTGAAATTACAGCATCACGAACACACTATAAATCATAAATTATATGCTGATAGAAAGCGAATTTACCGATTCCATATAAAAACATGATTATATATGGTAATGTGTACCCTGTAAAATATGTATGGCAGTGAGCAAAACTGAATTTACCTCCACAACAGGAACACCCATCAGTCTTAGTAGACGCTTACAATCATCATTGTGCTGCTTCGTGACCTGCTCATAAAGGACATGGAAAGATGTAAAGCTAGACCTTACTCTGAAAACTAATTCATCGCATATACTCTTACATAACATCACTTTATGCAAATAAAAATATACAAAAATTCAGTTGATAATTGATCAGTGAAAGAACCAGTTGGCTCCTAACACAATGCAAATCGTCTTACATTAAGGAGATTACGACTGATGAAAATTTTCAAGACTCTTTATCACAAACAACTGAAAATAATAATTTCTCACCTTTACAGTTCTCTTGCTGAATTTTTCAATTGCATCCGTATCTCCTGCCTAGAACAACAAAATGCATTCCCCATAGGGGTCAAAAAAGAGAGCATAGAAGAACGTGGATAAAAAACTGATCAAAGCAACGTCAGCAAACCTCTACTGCCTTCGTCAGCTCTTCTGTTGCTTCATTCCTCTTTGCGTGTCTGACAAGTATTCCAGGTTAGCATTGTATAACCTAAAAAGTAGTGTAGGCAAACATATAAAGTGTGCTAGGAAACAACCAACGGATAAATAACCTTTTTAAAAGCTCGTCCTTCTTCATTTCAGGAGGCTTGCCATCAAAAACATATCTGCATGAGCAATGTTGTGACCCCGTTAAAAATAGACTTATATTTTCAGCTGTAATTATATGGAAGACTTCTGATANTGAGAAAGAAAGAT
Type
EST
SNP
PCR primers
BG263233B_F2 GGTGAAAACAAGAAGGTAGTGAAC
BG263233_cpF1 CGAGGCAGGAATTAAACCAG
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01