Query (optional)   in Class  

GrainGenes Probe Report: BG263233-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG263233-1D
Data at Wheat_SNP
BG263233-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>A;T>C;T>A;T>C;T>C;C>T at 27;152;153;272;321;554;556
SNP G>A;A>G;A>G;A>T at 397;399;632;681
Reference sequence ATTTTCCTATAATTACATCTGAAAATATCAGTCTATTTTTAATGGGATCACAACATTGCTCATGCAGATATGTTTTTGATGGCAAGCCTCCTGAAATGAAGAAGGACGAGCTTTTAAAAAGGTCATTTATCCTTTGGTTGTTTCCTAGCACTTTTTATATGTTTGCCTACACTACTTTTTAGGTTATACAATGCTAACCTGGAATACTTGTCAGACACGCAAAGAGGAATGAAGCAACAGAAGGGCTGACGAAGGCAGTAGAGGTTTGCTGTCGTTGCTTTGATCAGTTTTTTATCCACGTTGTTCTTCTATGCTCTCTCTTTTGACCCCCTATGCGAAATGCATTTTGTTGTTCTAGGCAGGAGATACGGATGCAATTGAAAAATTCAGCAAGAGAACTGTAAAGGTGAGAAATTATTATTTTCAGTTGTTTGTGATAAAGAGTCTTGAAATTTTTCATCACTCGTAATCTCCTTAATGTAAGACGATTTGCATTGTGCTAGGAGCCAACTGGTTCCTTCACTGAGCAAGTATCAACTGAATTTTTGTACCTTTCTTTTGCATAAAGTGATGTTATGTAATATATGCGATGAATTAGTTCTCAGAGTAAATTCTAGCTTTACATCTTTCCATGTCCTTTATGAGCAGGTCACGAAGCAGCACAATGATGATTGTAAGCGTCTACTAAGACTGATGGGTGTTCCTGTTGTGGAGGTAAATTCAGTTTTGCTCACTGCCATACATATTTTACAGGGTACACATTAACATATATAATCATGTTTTTATGTGGAATTGGTAAATTCACTTTCTATCAGCATATAGTTTATGATTTATTGTGTGTTCGTGATGCTGTTAATTTCACTTAAAGTTCCCTCTCCTGTACCACCAATAGGCTCCTTGTGAAGCAGAATCACAATGTGCTGCCCTTTGCAAGAATGACAAGGTAATATTAACATAGTGGACTTCCGCTACCTTCTTGTTTTCACCCTCTGCTTCCATTTTTATTTAGTACAGTTTATTTGTAGGT
Reference sequence AATATTACCTTGTCATTCTTGCAAAGGGCAGCACACGAGTGATTCTGCTTCACAAGGAGCCTATTGGTGGTACAGGAGAGGGAACTTTAAGTGAAATTAACAGCATCACGAACACACAATAAATCATAAACTATATGCTGATAGAAAGTGAATTTACCAATTCCACATAAAAACATGATTATATATGTTAATGTGTACCCTGTAAAATATGTATGGCAGTGAGCAAAACTGAATTTACCTCCACAACAGGAACACCCATCAGTCTTAGTAGACGCTTACAATCATCATTGTGCTGCTTCGTGACCTGCTCATAAAGGACATGGAAAGATGTAAAGCTAGAATTTACTCTGAGAACTAATTCATCGCATATATTACATAACATCACTTTATGCAAAAGAAAGGTACAAAAATTCAGTTGATACTTGCTCAGTGAAGGAACCAGTTGGCTCCTAGCACAATGCAAATCGTCTTACATTAAGGAGATTACGAGTGATGAAAAATTTCAAGACTCTTTATCACAAACAACTGAAAATAATAATTTCTCACCTTTACAGTTCTCTTGCTGAATTTTTCAATTGCATCCGTATCTCCTGCCTAGAACAACAAAATGCATTTCGCATAGGGGGTCAAAAGAGAGAGCATAGAAGAACAACGTGGATAAAAAACTGATCAAAGCAACGACAGCAAACCTCTACTGCCTTCGTCAGCCCTTCTGTTGCTTCATTCCTCTTTGCGTGTCTGACAAGTATTCCAGGTTAGCATTGTATAACCTAAAAAGTAGTGTAGGCAAACATATAAAAAGTGCTAGGAAACAACCAAAGGATAAATGACCTTTTTAAAAGCTCGTCCTTCTTCATTTCAGGAGGCTTGCCATCAAAAACATATCTGCATGAGCAATGTTGTGATCCCATTAAAAATAGACTGATATTTTCAGATGTGATTATATGGAAAATTTCTGATATTAGAAATGAAANGAATTTGGGAT
Type
EST
SNP
PCR primers
BG263233_cpF1 CGAGGCAGGAATTAAACCAG
Sequence
NSFT03P2_Contig3870
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01