Query (optional)   in Class  

GrainGenes Probe Report: BG263263-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG263263-2A
Data at Wheat_SNP
BG263263-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 492
Reference sequence TAGTCTGAACTTCTCATACATGCTTGTTTTAGTTGGGGGCGTAACCAAAATGGCCAGCTTGGCCTTGGAACTACTGAAGATTCGCTGCTCCCACAAACGATTCAAGCTTTTGAGGTACAATATTCTTCTTATGTGCTATTTTTAGATAGCAAATGCAAATATATGATACAAGGAAAAGAAAATCTAGTGTCATCTTCCTTGATACTTGTCCATGACAGCAATCTTTTGATTGCATTTTGTTACGGTAGGGATCCCCTACCGGGGAAGCGTGCCATGTGGAAATAATTGCTATGATTTGTAGTATTCGATATACAGACCAACATGACATGTAATGTAGGTGGGATCCTGTCAGATTACTGTGATGGGCATTCCGTCATTTATACGTAGGTACCACTCTGATATAGACATCAGTGAATAGCACCGTGTTAATGATAAACAAATAACCTTTAAGTATACTTATCTTCTAAAAAATTATCAACAAATATAATAAAACTTGTGTGGGAATGCAGACATGCTGACCTTCTAATGAATATGATGTGCAAGGTTATTAAGAGCTAATGGTCCAAAATGTGTAGGGTATTTCTGTGAAGATGATTGCTGCTGGTGCCGAACATACTGCTGCAGTAACTGAAGATGGCGAAATCTATGGATGGGGCTGGGGTCGATATGGAAACTTGGGTC
Type
EST
SNP
PCR primers
BG263263A_F1 GATCTTCGAGTGACTGTTACTCTAG
BG263263_cpR1 CGATCACCAAGACCCAAGTT
Sequence
NSFT03P2_Contig18507
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01