Query (optional)   in Class  

GrainGenes Probe Report: BG263563-4B

Probe
BG263563-4B
Data at Wheat_SNP
BG263563-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 266
Reference sequence CATCAGAGGTATCTGGTCTACCTGGTATTGGAGATGTTACCGGAAGAATTGCTTCACCATCGGCAGGTCAAGGTCTTCAGGCTGGATCGATGGGAGATTCACTAGGTGCTGTGCGGAATGCTGCCCAAGCTGCTGCTCGGATATATCAAGTTTTCAGGGTGCAGTCCTTCCAGAGAAAGCAAGCAGTTCAGTATGAGGATGACAATGGTGTGATATCAGATGAACGTGCCATGTCACTCTTGTCTTATAAACCATCTAAACCAGGGCAATTCGATCCCATGCATGCTGCTGCAACTCGAATACAAAACAAATTCTGTGGATGGAAGGGAAGA
Type
EST
SNP
PCR primers
BG263563B_F1 GGGAGCAATGCATCAGAGG
BG263563_cpR1 TTCTTCCCTTCCATCCACAG
Sequence
NSFT03P2_Contig13936
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01