Query (optional)   in Class  

GrainGenes Probe Report: BG273991-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG273991-4B
Data at Wheat_SNP
BG273991-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>C;INS;C>T;DEL at 38;41;43,1;81;1027
Reference sequence AAATGGAAAACGACTATCTGAGGTATGGGCACCCTCCCTCTCCACCCCGCCCACACACATTGCTTATTGGCTAGCTAGTTCAAAAAACAACATTGCGGTTTTTCATTTATTTATGGGCTCCTGTGGGGTGTGTGCGCCTGCATATAAAAATATCCAACATAATTTGGTAGAGCATCTGAGCATGTTAGAATATTTGTACATGTGAATAGTTGTGTAGTAAAAATAATTGCATGCACTGTGCTAGAAAGATAAAAGATTGCCAGAAGGGAAACATTTGGGCCTTCTCGACCAGTCAATTTTGAGGGGCTTATGAGATGTTAGCTGACTTGGTTCTTCCTTTCTTTTACTTATTTTTGCTAAGATCTTCTTCCGTTTATATTCGTTTTCATGTGAAAAATAATAATGTTTGGCTACTTCATCATAACATTTTTTAACCTGGGCTTGGTTGTTGATGATATATTTTAATATCTCTAGGGCCCTAATTCTTTTTGACTTTGATCATATGGTAGGAATGAACGTTGATACGCTGAATCATAACAAAATGAACAGTGAATATCACTTAGATATTTTATTTATTCAAATAAAGTTACACTGTTTTCCTATTTTTCTCAAGAATTTGTTCTTCAACTCGCATGTTTCATATGCCTGGCAATAATCTAATAACCAACAGCTTACTATGTACAGAGATTTCAGTTGCGTCGCATTTCTGAAAACTTTAACTAGCTTTTGTTGATCTTTAATTCCTTGTGCACTCTCACTCATGACACCAGTTCCATTTTACTAGTTTGTTGTTGACTTTTCTCTGTTTAATTGATGATAGTTCTCTCAACACCGTTTTCCCTCTTGTTGCAGCTTGAGCAAGAGGGCTTCGATGCTAGATGTGCATCTGGAGTGCCAGGACTTGGAAAGGATTTCAATCGTAAATCGTCTGGGAAGATTCCATGGCCGAAACCATGCAGCTGGTGTCGAGGCCTCATCTGGCTCACAAATGGTTTCTCGCAGAATTTTCCCTGATAGACATGTAATGTCTTTCT
Type
EST
SNP
Sequence
NSFT03P2_Contig12238
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01