Query (optional)   in Class  

GrainGenes Probe Report: BG274294-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274294-1B
Data at Wheat_SNP
BG274294-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>G;C>T at 348;353;685
[ Show all 6 ]
Type
EST
SNP
PCR primers
BG274294B_F1 AGAGGCATGACATTGAAAAACAG
BG274294_cpR1 AGCCCACCCTTTCTTCTTGT
BG274294_cpR1 AGCCTTCCACCATGTTTTTG
BG274294_cpR1 TTCCCGAGTATTCCTTGCAC
Sequence
NSFT03P2_Contig17415
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01